353535

agni

Dagobah Resident
Did anyone figure out 353535 code mentioned in transcripts ? If so, does it have anything to do with a "pivot point" or "median" ?
 

Pierre

Administrator
Administrator
Moderator
FOTCM Member
agni said:
Did anyone figure out 353535 code mentioned in transcripts ? If so, does it have anything to do with a "pivot point" or "median" ?
I don't have the answer. There are only two hypothesis that I could think about.

1/ The 353535 code could describe the human condition, i.e. the permanent cycle of reincarnation, that is the permanent shifht between 3rd density (as human beings) and 5th density (death density)

2/ It could also describe the energy usurpation that happen between the 3rd chakra (lower emotional center) and the 5th chakra (lower intellectual center)
 

agni

Dagobah Resident
How about "half way there", seeing two equal sides, aka 7/2 = 3.5 ... interesteng that by dividing these primes (7,2) you get another set of primes located between them.(3,5)
 

John G

The Living Force
Besides primes, I think the transcripts mention inverted triangles (353 vs 535). There's a cycle in there too, 35-35-35, it could mean many things.
 

ark

Administrator
Administrator
Moderator
FOTCM Member
If you read Answer to The Ultimate Question Of Life, the Universe, and Everything the answer should be 42. But this may well be a code. 4+1=5 and 2+1=3, so we get 53. Which reversed is 35.
On the other hand, going deeper into The Code Problem we can find that:

The sequence of DNA can be analyzed for open reading frames (usually done by computer). Open reading frames are stretches of DNA that do not contain stop codons (UAA, UGA, UAG). A segment of double-stranded DNA has six possible reading frames, three in each direction.

Consider the double-stranded DNA sequence below

5' CAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAATCCGAG 3'
3' GTTACCGATCCATGATACATACTCTAGTACTAGAAATGTTTAGGCTC 5'

If we convert the top and the bottom sequences to RNA, the three frames of the top strand could be represented as follows:

1. 5' CAA UGG CUA GGU ACU AUG UAU GAG AUC AUG AUC UUU ACA AAU CCG AG 3'
2. 5' CA AUG GCU AGG UAC UAU GUA UGA GAU CAU GAU CUU UAC AAA UCC GAG 3'
3. 5' C AAU GGC UAG GUA CUA UGU AUG AGA UCA UGA UCU UUA CAA AUC CGA G 3'

The three frames of the bottom strand could be represented as follows (remember this is shown 5' to 3')

1. 5' CUC GGA UUU GUA AAG AUC AUG AUC UCA UAC AUA GUA CCU AGC CAU UG 3'
2. 5' CU CGG AUU UGU AAA GAU CAU GAU CUC AUA CAU AGU ACC UAG CCA UUG 3'
3. 5' C UCG GAU UUG UAA AGA UCA UGA UCU CAU ACA UAG UAC CUA GCC AUU G 3'
Last, but not least, typing in Google:
"3-5" code
the first entry that comes is (suprise, suprise! :) )

http://www.cassiopaea.org/cass/wave13.htm
 

Pierre

Administrator
Administrator
Moderator
FOTCM Member
Here is a transcript mentioning the 3-5 code :

session951111 said:
A: Look: 353535.
Q: (L) What is the 35 sequence?
A: 5 minus 3.
Q: (L) Okay, we have strange math. But, you can do anything
with numbers because they correspond to the universe at
deep levels...
A: Is code.
Q: (L) What does this code relate to? Is it letters or some
written work?
A: Infinite power.
Q: (L) How is infinite power acquired by knowing this code?
If you don't know the correspondences, how can you use a
numerical code?
A: Lord of Serpent promises its followers infinite power
which they must seek infinite knowledge to gain, for which
they pledge allegiance infinitely for which they possess for all
eternity, so long as they find infinite wisdom, for which they
search for all infinity.
Q: (L) Well, that is a round robin... a circle you can't get out
of!
A: And therein you have the deception! Remember, those
who seek to serve self with supreme power, are doomed only
to serve others who seek to serve self, and can only see that
which they want to see.
I bolded the last part. It's the one I refered to concerning the infinite cycle of reincarnation hypothesis (3rd density - 5th density shifts)
 

mamadrama

The Living Force
Axel_Dunor said:
I bolded the last part. It's the one I refered to concerning the infinite cycle of reincarnation hypothesis (3rd density - 5th density shifts)
Thanks, Axel this really resonated with me. Maybe it's the poetic blend of mathematics and metaphor creating a sort of meronym but whatever it is, it is intriguing:)
 

snaketracer

The Force is Strong With This One
Its funny that the Cassiopaeans said 353535.. 5 minus 3. Which is 2.
When we look at our dna we have 22 pairs of chromosomes, the 23rd pair is the sex chromosomes but on on higher density's we are neither male nor female.
Only 2% of our dna is actually used, and the other 98% of it is referred to as junk.
Dna consists of 2 strands which run in opposite directions to each other.
Thats a few 2's to mention!

I was just pondering, I have to think in simple terms, I was so bad at maths at school!

Maybe 353535 is the key to gravity... they said the code relates to infinite power... and gravity is everything... :)
 

Buddy

The Living Force
Re-reading the transcript Belibaste posted, I was prompted to think of the transcript as a potentially useful formula for waking people up to that psychopath/authoritarian follower dynamic they have been trapped in.

It sounds kinda silly, but we could say 3 represents the 'trinity', while 1 more represents an authoritarian person in religion or politics while the remaining 1 (which makes 5) represents the common man (or that both represent 'religion' and 'politics').

Or, subtract the original 3 (trinity), from this total of 5 and you're left with the 1 person seeking religious/political power (serpent) and the 1 that can grant it (Lord of Serpent).

In this context, since the real trinity or "Absolute" is being used as a deception based on people's en-cultured fantasies, the 2 is all that really exists - and it is they who don't 'believe'.


This part that was bolded reads like it would make a useful template to create a parable of sorts, or a story which could 'seed' an awakening in the reader, possibly.

A: Lord of Serpent promises its followers infinite power
which they must seek infinite knowledge to gain, for which
they pledge allegiance infinitely for which they possess for all
eternity, so long as they find infinite wisdom, for which they
search for all infinity.
Q: (L) Well, that is a round robin... a circle you can't get out
of!
A: And therein you have the deception! Remember, those
who seek to serve self with supreme power, are doomed only
to serve others who seek to serve self, and can only see that
which they want to see.

I know...what I wrote has nothing to do with DNA and it may be silly, but it's a bit of a mental stretching exercise anyway, OSIT. Maybe there's a DNA link in there, somewhere. At any rate, stretching is good, I think. :)
 

TOTEM36

Jedi
Belibaste said:
Here is a transcript mentioning the 3-5 code :

the infinite cycle of reincarnation hypothesis (3rd density - 5th density shifts)

This idea was the way i was thinking too, back and forwards, back and forwards, 5th to 3rd, 5th to 3rd, until at some point - smash- disentegrated to become primal matter.
 

cubbex

The Living Force
ark said:
http://www.cassiopaea.org/cass/wave13.htm
13?!! well I'm getting paranoid with this number and by coincidence I got to read this, like I was trying to point to myself this chapter. Also its interesting I've read this on one link you posted about the science fiction comic:

Some readers subsequently noticed that 6 × 9 = 42 (using base 13). Douglas Adams later joked about this observation, saying, "I may be a sorry case, but I don't write jokes in base 13."
Lol... OH there is a flying wale outside my window!

ohoho another one

Douglas Adams was asked many times during his career why he chose the number 42. Many theories were proposed,[6] but he rejected them all. On November 3, 1993, he gave an answer[7]
6+7= 13

I've read a thread posted in this forum about the order inside the chaos, and in one link it talks about coincidences, I've read the synchronicity from jung a little and, well, maybe all is inside our heads. The number 35 and what it may be looks pretty fantastic to me but just imagine all the coincidences with number 2,3 and 5, there may be a lot, but surely coincidence doesn't exist and on a seemingly coincidence one of these days some folks will discover what it means.
 

weasel3d

Jedi
Belibaste said:
Here is a transcript mentioning the 3-5 code :

session951111 said:
A: Look: 353535.
Q: (L) What is the 35 sequence?
A: 5 minus 3.
Q: (L) Okay, we have strange math. But, you can do anything
with numbers because they correspond to the universe at
deep levels...
A: Is code.
Q: (L) What does this code relate to? Is it letters or some
written work?
A: Infinite power.
Q: (L) How is infinite power acquired by knowing this code?
If you don't know the correspondences, how can you use a
numerical code?
A: Lord of Serpent promises its followers infinite power
which they must seek infinite knowledge to gain, for which
they pledge allegiance infinitely for which they possess for all
eternity, so long as they find infinite wisdom, for which they
search for all infinity.
Q: (L) Well, that is a round robin... a circle you can't get out
of!
A: And therein you have the deception! Remember, those
who seek to serve self with supreme power, are doomed only
to serve others who seek to serve self, and can only see that
which they want to see.
I bolded the last part. It's the one I refered to concerning the infinite cycle of reincarnation hypothesis (3rd density - 5th density shifts)

I'm not a mathematician (by far). But isn't the 3/5 approximately the Golden Section .618 which is related to Phi, which is related to endless spirals fo the Golden Ratio, etc.---which are like the basis of most 'everything' in 3D reality (and what the Cs are speaking of here)?

So your STS ends up serving the endless spiral looping into fractal infinity, never coming around to complete any circle, or perhaps find self. At least I think that that's what they're getting at here...or partially perhaps.

Anyone wish to correct me, or fill me in on a better forum conversation on this topic?
 

mkrnhr

SuperModerator
Moderator
FOTCM Member
There is also a discussion in the Wave 8 about the connection of this code to DNA activation through the Work FWIW.
 
Top Bottom