Coronavirus Pandemic: Apocalypse Now! Or exaggerated scare story?

[Laurs]

In a move of pure evil, this psychopath from the banking sector is ruining severely sick and dying kids' chances of making a last wish: Richard K. Davis, CEO of Make-A-Wish Foundation, just stated that in order to get their wish granted, such a child must be vaccinated .... never mind that most of these kids are too sick to risk any vaccination!

Kids: Make a Wish — But Only if You’re Vaccinated

Kids: Make a Wish — But Only if You’re Vaccinated

blogs.mercola.com

 

[Hi_Henry]

Here is how, in my opinion, clarity from a scientist looks and sounds. After listening to this presentation, a viewer will know exactly where the scientist stands on the question of Covid.

The presentation is by one of my favorite Stanford professors (the other is Dr. Jay Bhattacharya) Prof. John Ioannidis.
Covid Reality

 

[JEEP]

This is on youtube so capture before it disappears - 2 and a half min:

FINALLY a Clinical Trial on Facemasks in Children - Parents Take Note!​

 

[axj]

If analysis of the entire study rules out the above assumption ("127 had vax in Trimester 1 and Trimester 2" from the v-safe Pregnancy Registry), then, carry on, nothing to see here.

It does indeed rule out the above assumption. What this tweet and the Natural News article missed is Table 3 in the study which shows the total number of pregnant women who got the vax in Trimesters 1 and 2:

https://www.nejm.org/doi/10.1056/NEJMoa2104983

 

[JEEP]

So there's a youtube vid in this article that is so horrifying I can hardly watch it to the end - the mad scientists playing god enmeshed in their Darwinian evolutionary beliefs - and belief is the key word here! My gut reaction is holy sh*t!

Alien Vaccines with Mutant Spikes​

The mRNA sequences in the coronavirus vaccines use alien genetics to hack the immune system. The non-natural genetic sequences and the pre-fusion design turn them into mutant spikes that could damage almost any part of the body, including the brain, ovaries and testes! In fact, according to the 2021 report from the European Medicines Agency, the mRNA in the Moderna vax were found to spread to all tissues in the body, and remained in the brain for 25 hours!

Many conscientious doctors have spoken out publicly about the vaccines and the horrors taking place; they include Dr Peter McCullough, Dr Roger Hodkinson and Dr Byram Bridle, who has pointed out the spike is potentially pathogenic since it could inflame cells in very sensitive areas of the body, especially those that express the ACE2 protein.

Instead of dying from infection, people die from the injections.

[vid of Dr. Bryam Bridle at Derek Sloans press conference]

Reinventing mRNA​

SARS-CoV-2 seems to be a lab-made construct, fashioned from viruses that normally live in bats and pangolins. The mRNA coronavirus vaccines are supposed to contain a copy of the genetic code for the spike protein, but instead of recreating the spike, the vaccines reinvent it. Like all genetic interventions created using synthetic biology, the coronavirus vaccines are playing God with genetics by:

• using different ingredients (a bit like using artificial sweeteners instead of sugar)
• changing the recipe by altering the words and the way they’re spelled
• including bits from other recipes (i.e. sequences from unrelated genes)
• putting a ridiculously long tail on the end to prolong the production of spike proteins

What the mRNA recipe creates​

When a recipe is delivered to a cell in the form of mRNA, a taskforce is ready to inspect the recipe and decide what to do with it. If the recipe was issued by our own DNA, it might get modified a little bit, and then it’ll probably get sent to the kitchen to be made by the chefs. If, however, it looks as if the mRNA came from a virus, there’s a chance the taskforce will mark the recipe for destruction, so it never reaches the kitchen at all. This is the last defence mechanism we have in terms of our immune system but the alien genetics in the vaccine-mRNA make the recipe seem safe enough so it gets sent to the kitchen, where the chefs make whatever they’re told to make. But what if they don’t understand the recipe? They’ve never seen recipes like this before so what if they get it wrong?

For that matter, what happens if they do make the spike proteins? Being fortified by the pre-fusion design makes them extra spikey, extra strong, and permanently battle-ready. The NIH considers them to be very potent, and an advert they posted in 2018 said they could induce 10x more antibodies than a wild-type virus!

When the structure of a lab-made coronavirus is studied using cryo-EM, the spikey bits on the coronavirus are seen to be regularly popping in and out. These are the bits that attach to ACE2 receptors but this only happens when they’re in the ‘out’ position (as observed in blood samples in the lab). It’s as if the virus only flashes its swords now and again, whereas the vaccine-spikes have been locked into the ‘out’ position with proline, so it’s as if their swords are permanently on show. This pre-fusion version of spike is like an alien warrior on the warpath looking for ACE2. What’s more, there’s a really long tail on the end of the vaccine-mRNA that makes sure lots of spikes get made, so it’s like an army of super-soldiers has been released. This could be a real shock to the body because there’s been no warning of an invasion; the use of unnatural genetic code ensures none of the usual alarms go off – there’s just a sudden onslaught of spikes.

[Here's the terrifying vid - 17:40]

Changing the Language of DNA and RNA​

[This section is intended to help explain what XNA is, as well as other mRNA modifications that will be described below. It’s also useful for understanding various other things, such as the gain-of-function research the NIH did with the Chinese, and why SARS-CoV-2 seems to be man-made, which will be covered in more detail in future articles!]

Nature uses 20 amino acids to create life – every living thing in the whole wide world uses combinations of these 20 amino acids to make proteins. DNA churns out code for proteins all the time. It does this by using a language that only has four letters: A, T, C, G. These letters stand for Adenine, Thymine, Cytosine, Guanine. A and T go together to make one base pair, and C and G go together to make another base pair.

RNA is a bit different because it uses uridine instead of thymine, so it uses A, U, C, G. (Thymine is also called methyluracil.)

Adenine, thymine, cytosine, guanine and uridine are nucleotides that incorporate phosphates and sugars to form a ‘backbone’. Combining these letters or nucleotides makes ‘words’, or codons, and each codon specifies a particular amino acid should be created. When the amino acids are combined together, they make a particular type of protein. All of this happens inside the cell.

• 3 nucleotides = 1 codon
• 1 codon = 1 amino acid
• Examples: the three nucleotides AAG form a codon which spells out the amino acid Lysine, whilst AGG forms a codon which spells out the amino acid Arginine.
• Most amino acids can be made using more than one codon. For example, Lysine can also be made with the codon AAA, whilst Arginine can be made with any of these six codons: AGG, CGT, CGC, CGA, CGG, AGA.
• Even though there are hundreds of amino acids, every living thing on earth is made from the same set of 20 amino acids.
• Antibodies are proteins!

Unfortunately, some bright spark worked out that the two base-pairs formed by DNA and RNA could be represented in computer code by using ones and zeros. This allows scientists to play around with genetic sequences more easily and even invent new versions using stuff that doesn’t occur naturally. There’s no end to what they can do with genetics so a huge amount of effort has been invested in building the industry in a ‘behind the scenes’ kind of way. The idea has been floated that mRNA could be used for ANYTHING, as if it could end up replacing modern medicine entirely despite the fact that most of the human genome is not understood! A whopping 85% of our DNA is dismissed as worthless junk, but new discoveries that prove this wrong are being made all the time.

How to play God with genetics​

Strands of DNA and RNA are formed by stringing together long chains of molecules called nucleotides. A nucleotide is made up of three chemical components: one of the bases (either adenine, guanine, cytosine, thymine or uridine), a phosphate, and a five-carbon sugar group. It’s possible to tinker with all three of these components by using different chemicals; the mRNA vaccines are altering the base by changing the uridine to pseudouridine, and there’s a possibility that changes have been made to some of the phosphate and sugar components as well. Altering any of the three components that make up a nucleotide creates what is known as a nucleic acid analogue, and when the sugar component is swapped for a chemical that’s never used in nature, it’s usually referred to as XNA (xeno nucleic acid). According to Wikipedia:

“Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research. Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pentose sugar, either ribose or deoxyribose, and one of four nucleobases. An analogue may have any of these altered. …. Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.”

Xeno Nucleic Acid (XNA) in the mRNA?

Xeno means ‘alien’ or ‘not of this world’ and xeno nucleic acids are classed as alien because they use chemicals that nature never uses. Several types of XNA have been invented so far, and these include: [NOTE: these last three words and beyond are not italicized in the article, but will not post correctly despite my attempts to remove the italics - affects the rest of the post ]

• Threose nucleic acid (TNA)
• Glycol nucleic acid (GNA)
• Locked nucleic acid (LNA) [ii]
• Peptide nucleic acid (PNA)
• Cyclohexene nucleic acid (CeNA)
• 1,5-anhydrohexitol nucleic acid (HNA)
• Fluoro Arabino nucleic acid (FANA)

Most (perhaps all) of Moderna’s patents refer to the possibility of using various types of XNA to make their products, in addition to using DNA and RNA. For example, the patent for Moderna’s Betacoronavirus mRNA vaccine was filed in February, 2020, and it describes the possibility of using: “threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs)[iii], ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.”

The motivation for using XNA is because it helps to stabilize mRNA, and because it protects it from RNases. All types of RNA are vulnerable to degradation because there are lots of RNase enzymes flying around all over the place. They’re literally everywhere – floating around in the air and coursing through our veins. This means precautions have to be taken to limit the effect of RNases during manufacturing; similarly, RNases in people’s bodies can totally destroy mRNA within minutes. Locked nucleic acid (LNA) does not activate RNase enzymes, so it would limit degradation of the mRNA. It’s said that locked nucleic acid (LNA) can be used to modify mRNA in order to stabilize it and get more of it get translated . Overall, LNA prolongs the half-life of mRNA which means more of it gets translated, and more proteins get made. LNA can also be used to stabilize the cap of mRNA, which is the very first bit of a mRNA sequence. (A cap made with LNA is available for sale here.) Another option is to incorporate some LNA nucleotides “at the ends of RNA and DNA sequences to form chimeric oligonucleotides…”

The EMA and the FDA have previously approved three types of non-natural nucleic acids for various diseases. These include Eteplirsen and Golodirsen which both have a morpholino phosphoramidate backbone, whilst others have a phosphorothioate and 2′ methoxyethyl backbone. The package insert for Golodirsen says every sugar has been replaced with a morpholino ring and every phosphate has been replaced with phosphorodiamidate, whilst the bases remain the same as normal. These modifications are a key feature of Golodirsen, whereas the most prominent modification of the mRNA in the coronavirus vaccine involves changing one of the bases. Instead of using uridine, the vaccines are using pseudouridine, as stated in all their documents. None of the documents refer to using LNA in the cap or anywhere else in the sequence, but it’s perhaps possible that there’s no requirement to report the use of LNA if it’s not a prominent feature. Golodirsen is a tiny construct compared to the mRNA in the vaccines, and a smidge of LNA in the cap might be shrugged off as a technicality.

The vaccines are heavily modified with pseudouridine

Instead of using uridine to make nucleotides, the Moderna and Pfizer vaccines both use N1mΨ, which is short-hand for the chemical formula ‘N1-methyl-pseudouridine’. Ψ is the symbol for pseudouridine which has different chemical properties to uridine so it affects the way the nucleotides function. Vaccine makers are saying it’s a natural thing because we sometimes make Ψ ourselves, but that doesn’t mean it’s normal for a virus to contain Ψ. What’s more, it’s not clear if humans ever make N1mΨ, which is a methylated version of Ψ, although it has been found now and then in the genetic sequence of some kinds of archaea.

The first part of the mRNA code for the spike protein of SARS-CoV-2 is:

GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC

But the mRNA vaccines have changed all the uridines to the N1mΨ version of pseudouridine, which is written like this:

GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC

The two researchers who came up with this idea were Katalin Kariko and Drew Weissman from the University of Pennsylvania. They published a paper in 2005 describing how mRNA made with pseudo-U was more likely to work than normal mRNA. Most scientists had given up on using mRNA for gene therapy because the immune system was able to destroy it but pseudo-U could trick the immune system into ignoring the mRNA, meaning it was more likely to get translated. A few years later, Kariko and Weissman made another discovery – using HPLC to remove bacterial residues from mRNA also helped it get translated. The production of mRNA involves using a bacterial plasmid, and this bacteria was contaminating the mRNA to such an extent that it triggered the immune system, which then destroyed the mRNA as well as the bacteria. Using HPLC to purify the mRNA made this less likely to happen, and in 2010, Moderna was founded and immediately began filing patents for mRNA made with pseudouridine. The pseudo-U technique was patented by the University of Pennsylvania and the patents were later assigned to the NIH.

Pseudo-U is epigenetic. So is methylation.​

Article continues - READ MORE - <snip> [as NOTED in previous quote box, I'm unable to remove the italics - it simply will not post correctly]

It’s difficult to see how this can be passed off as ‘mRNA’ when it’s really nothing like it. The Reset Crew are scrambling desperately to cover up the effects of the vaccines, perhaps with the knowledge that they have to get us all hooked up with a global vax-ID in time for the roll-out of the Central Bank Digital Currencies, and well before the Global Holodomor that’s currently being orchestrated. After that, the genetic potions would be used to control everyone with a never-ending supply of variant-specific ‘boosters’!

The antidote to all this is being sure of who we are.

[12:29]

 

[avia]

Hi @lillies. I'm not sure you were actually hypnotized by this person, but she certainly did trigger in you your traumatic experiences with that abuser, seeing how the "stealing" incident came up the way it did. And I could see how the whole experience might have felt "hypnotic."

Nemesis is a pretty powerful word. It might be useful to look into its Greek origin to see more specifically why your psyche might have chosen that word in particular.

Starting with Merriam-Webster:
1 capitalized : the Greek goddess of retributive justice
2 plural nemeses\ ˈne-mə-ˌsēz \
a: one that inflicts retribution or vengeance.
Many a pursued man fell before his nemesis in the streets …— Agnes Morely Cleaveland
b: a formidable and usually victorious rival or opponent.
The team was defeated by its old nemesis.

Sometimes we are drawn to someone we might term our nemesis. There could be a "petty tyrant" angle to that. As you were suggesting, we seek to prove our invulnerability before someone who in fact causes us to feel vulnerable.

It does seem as though something in this woman's energy has you feeling uncentered, or disconnected. Hopefully, you can stear clear of her for the most part. I would even leave the vicinity to avoid her, and return to my errand at a later point. There's no defeat in that; instead it's more to do with having healthy boundaries, and taking charge, and knowing what your vulnerabilities/limitations are.

Good luck with this, lillies. So sorry you have to have such a person in your midst.

As to "the jab"... remember, lillies, there will be, there IS a growing resistance. There are constitutional lawyers, doctors, independent journalists, and just plain fed up people who are looking into ways of confronting this tyranny. People in the tech field--hackers especially--who will find ways of circumventing government intervention into all our lives, including the mandating of vaccine passports, etc. Each move the PTB makes is met with a counter measure; the more they reveal their hand, the more push-back takes place. Many state governors are now banning Critical Race Theory in schools, for example. So, this cabal is seeing some serious set-backs.

There are those who feel the PTB has revealed too much too soon; that they were not ready to really "seal the deal," as it were. This may well be the "exposure" the C's were talking about. Yes, many innocent people are dying and will continue to die due to the vaccines. But, especially since so many are having adverse reactions to these vaccines, doubt is beginning to set in, even if just through word of mouth. So, nothing is static about this situation. What heretofore has seemed unalterably polarized might in fact be breaking down.

Also, people are coming to the conclusion that the best way to fight this tyranny is to act to create the reality that they want to be a part of. Ideas like "food forests" are coming to bear. This uses the idea that many home owners have land -- even an unused front yard -- that could be used in a sustainable, well thought out way in order to provide fruit, berries and vegetables, etc.-- all in abundance. It's based on how a forest works. You can have large fruit trees, or just dwarf fruit trees, surrounded by berry bushes of different kinds; perennials like asparagus, different kinds of onions, garlic, even ginger -- oh, and the robust herbs that can handle the winter, depending on where you live. You can add to that annuals, which, if you harvest them correctly, provide the seeds for the following year. If this idea catches on -- note: there are financial entities buying up single family homes en masse in some places, in order to force would-be home owners to become renters, so there are some serious problems with home ownership -- but if families who own their own homes start to use even their small plots of land wisely, who knows what could be possible. We're talking about A LOT of unused land that could suddenly be sustainably developed for food production, and which will be contributing to a "true" greening of the suburban environment; land that could be providing food to share with the community during increasingly uncertain times.

Briefly, here's some info on food forests. There are many people talking about this on Youtube, actually; people who are sharing their own experiences with doing this type of gardening. The following was sent out regarding something called the TexasNexus Event:

Hello Food Forest Abundance Family!

Food Forest Abundance Founder Jim Gale shared the stage in front of a packed crowd of 450 at the TexasNexus Event:

Integral Foundations: Systems Architecture For Humanity With Dr. David Martin in Spiceland, Texas

What is The Texas Nexus? The Texas Nexus is a network of individuals who value personal freedom.

Top Ten reasons to grow your own food and medicine...

Convenience - It is EASY! Perennials (fruit and nut trees, berry bushes, etc.) take less maintenance than lawns. You do not have to become a "farmer" (in the traditional sense) to grow a lot of food. Think of a cherry or apple tree... These trees will provide hundreds of fruits per year with almost no effort.

Now, instead of 1 or 2 fruit trees, imagine 10 in a suburban yard, all different species. Now, add to that perennial roots and tubers, like ginger, turmeric, sweet potatoes, add grape vines and 3 types of berry bushes, add medicinals like elderberry and lavender, herbs like rosemary and thyme... The list goes on and on!

ROI… The average return on investment blows away any other market sector! Let's take a peach tree for example. A healthy peach tree will produce 150 lbs of peaches per year... $3 lbs x 150 = $450. Well over 100% $ROI annually once mature, and that's just $ ROI!

FOOD SECURITY... The food supply chains are failing. Most of our food comes from 1,500 miles away, is handled by 6 to 7 people, and requires 4 to 5 vehicles. Unsustainable!

TASTE... Ripe fruits = much better taste and more nutrition.

ANXIETY and STRESS... are more prevalent now than ever. Gardening is found to be as effective as prayer/meditation for helping with these ailments.

REVERSE DEFORESTATION... When we transition 20 to 50% of our lawns into Food forests, we reverse deforestation.

REVERSE MASS EXTINCTION... As we transition our lawns into foodscapes, the industrial monocrops farms will go back to nature.

SOIL... We are currently destroying our topsoil at a rate of 10 to 40 x the rate of replenishment, "we only have 2 generations of soil left." If this were the only stat, would it not be enough?

Disease and DIS-EASE... This is because of the poisons we consume. No more poisons!

FREEDOM… All paths to lasting freedom (from everything from tyranny to cancer) must include a decentralized. regenerative and local food supply.

Jim Gale has a website, foodforestabundance.com (which I am going to check out after finishing this post). In the following video he's talking about the TexasNexus event he just spoke at. He has some inspiring things to say about.. really the "people's" movement against tyranny that's springing up across the country in differing ways. He gets choked up as he speaks. It's rather touching to watch. And hopeful.

I'm not a rose-colored glasses type of person, but I do think that in focusing on some of the positive counter measures going on we are supporting this idea of creating a better reality in a "real" sense, not a wishful thinking sort of way. It's really a down here on the ground sort of way.

And, no, lillies, you will not be forced to take a vaccine. We must all find the ways that motivated people are coming up with to circumvent these measures. We must. And we can. Stay tuned here at the forum. These ideas will be shared here no doubt. We just have to keep our eyes and ears open and find out who is doing what, and how we can in some way participate.

Part of this effort is to start to look around you locally, see who you know, what are the local resources. Can you start communicating with people about what happens if there is a financial collapse or another type of calamity? What can we do locally?

I'm not saying any of this is easy. I did my first email along these lines, reaching out to someone I just met, and I never heard back from her. Email can be like that sometimes; maybe she never even saw my email. So, there are always going to be setbacks. And, even though upstate New York largely votes "red," it's still a blue state, with all the bad policy that accompanies that. So, again, we have to think more locally. I, myself, am planning on fencing in a piece of my backyard (we have deer up here who would otherwise feast on all of my efforts), but I am going to start a food forest within a fenced in area. A lot of plants can actually be planted in the fall, so there's always a time of year when you can be doing something. I'd like to set up some sort of a green house as well for herbs that can't handle the winter months. So, it's a year round project.

Anyway, I'll keep you all posted as things progress with this. My hands are tied until we get in some drainage that will be beneath where the food forest will be. So, it's first things first. But we just had gravel dumped in our yard for that. So things are progressing... along with the continued project of finishing our "fixer upper" (quite an undertaking, I'm afraid, but it's finally happening -- that is, we're finally doing it!).

Be well, you all. You too, lillies.

Hi @Heather , thank you for bringing up the subject of food forests. I think this important information needs its own thread, maybe in the gardening section of the Health and Diet forum. Would you consider opening such a thread? If so, I would definitely participate! This corona thread has many offshoots into off topic subjects, food forests is a stand alone subject, imo.

 

[Gaby]

It does indeed rule out the above assumption. What this tweet and the Natural News article missed is Table 3 in the study which shows the total number of pregnant women who got the vax in Trimesters 1 and 2:

So it's another example of how those against the vaccine should look before they leap in order to not discredit themselves.

https://www.nejm.org/doi/10.1056/NEJMoa2104983

Among 827 participants who had a completed pregnancy, the pregnancy resulted in a live birth in 712 (86.1%), in a spontaneous abortion in 104 (12.6%), in stillbirth in 1 (0.1%), and in other outcomes (induced abortion and ectopic pregnancy) in 10 (1.2%). A total of 96 of 104 spontaneous abortions (92.3%) occurred before 13 weeks of gestation (Table 4), and 700 of 712 pregnancies that resulted in a live birth (98.3%) were among persons who received their first eligible vaccine dose in the third trimester. Adverse outcomes among 724 live-born infants — including 12 sets of multiple gestation — were preterm birth (60 of 636 among those vaccinated before 37 weeks [9.4%]), small size for gestational age (23 of 724 [3.2%]), and major congenital anomalies (16 of 724 [2.2%]); no neonatal deaths were reported at the time of interview. Among the participants with completed pregnancies who reported congenital anomalies, none had received Covid-19 vaccine in the first trimester or periconception period, and no specific pattern of congenital anomalies was observed. Calculated proportions of pregnancy and neonatal outcomes appeared similar to incidences published in the peer-reviewed literature (Table 4).

It might not be the most encouraging of studies, but still, no need to distort its results.

 

[lostinself]

It does indeed rule out the above assumption. What this tweet and the Natural News article missed is Table 3 in the study which shows the total number of pregnant women who got the vax in Trimesters 1 and 2:

https://www.nejm.org/doi/10.1056/NEJMoa2104983

Yes, and there's also the fact that miscarriages have precedence over successful births when it comes to getting included in the results of this particular study. This was what actually mislead me. And the other 700 women were enrolled into study in their 3rd trimester (presumably shortly after getting vaxxed) and gave birth in regular manner soon enough to get themselves included in preliminary results. In this respect, the results brought by the report are actually flawed, although concluded ratios happen to match expected ones. We'll have to wait for all ~4,000 pregnancies to resolve to learn reliable results.

 

[cope]

Va...xxination site. While some wait in line to get a shot, the one who has gotten 1, is being carried away (Russia?)

https://twitter.com/x/status/1411043040769318914

can you say beehhh?

 

[cope]

Sorry Ruth, hadn't checked your post in side effects thread.

 

[cope]

Today my child overheard a friend mulling about taking the jab. What to do?
Fridays mailing of Dr Mercola seemed appropriate to send her:

If You've Had COVID You're Likely Protected for Life​

Which One Is More Dangerous?

A September 2021 study analyzed data from the government's inoculation programs. Here's what the findings show about the risks of the jabs versus the infection.

articles.mercola.com

 

[cope]

timelimit..
There is also something else new in there:
As I’ve previously warned, if you’ve had COVID-19, please don’t get vaccinated. Dr. Hooman Noorchashm, Ph.D., a cardiac surgeon and patient advocate, has repeatedly warned the FDA that “clear and present danger” exists for those who have had COVID-19 and subsequently get vaccinated.
At issue are viral antigens that remain in your body after you are naturally infected. The immune response reactivated by the COVID-19 vaccine can trigger inflammation in tissues where the viral antigens are present. The inner lining of blood vessels, the lungs and the brain may be particularly at risk of such inflammation and damage. According to Noorchashm:

“Most pertinently, when viral antigens are present in the vascular endothelium, and especially in elderly and frail with cardiovascular disease, the antigen specific immune response incited by the vaccine is almost certain to do damage to the vascular endothelium.

Such vaccine directed endothelial inflammation is certain to cause blood clot formation with the potential for major thromboembolic complications, at least in a subset of such patients. If a majority of younger more robust patients might tolerate such vascular injury from a vaccine immune response, many elderly and frail patients with cardiovascular disease will not.”

Noorchashm quoted one of his previous medical school professors, who said, “the eyes do not see what the mind does not know.” By this, he meant that in the case of a vaccine-induced antigen specific immune response, which may trigger thromboembolic complications 10 to 20 days after vaccination, including in those who may already be elderly and frail, the reaction isn’t likely to be registered as a vaccine-related adverse event.
Because so many cases are asymptomatic, Noorchashm recommends clinicians “actively screen as many patients with high cardiovascular risk as is reasonably possible, in order to detect the presence of SARS-CoV-2, prior to vaccinating them.” As it stands, Noorchashm points out that by ignoring what he believes to be an imminent risk for a sizable minority of people, the FDA’s credibility, and that of the mass vaccination campaign in general, is at grave risk.

 

[dredger]

Hello,
An not so old article of 09/2019 regarding the dengue and the dengvaxia vaccine from sanofi, written by the well know Dr Delepine in France. Very interesting, I recommend its reading, not so long. There are many similitudes with what we are experiencing now. I wonder how healthy are nowodays all those who were jabbed ?

You can read it auto-traduced in english, here's the link
French original link : Analyse d'une catastrophe sanitaire annoncée, la saga du Dengvaxia, vaccin contre la Dengue

 

[hlat]

In Arizona, hydroxycholoquine is back. Executive Order 2021-16 rescinds Executive Order 2020-20 effective July 9, 2021.

https://azgovernor.gov/file/37939/download?token=_FAy7p7A

https://azgovernor.gov/file/34427/download?token=o9QtVltb

Office of Governor Katie Hobbs | Executive Orders

Executive Orders from the Office of the Governor

azgovernor.gov

Are all these 6s tied to the C's Visa prediction that may manifest as money tied directly to the body, money that is completely traceable and controllable by the government? Not exact 666, but 060606 and 6666.

Here we go ladies and gents, it is all coming together now (mark of the beast and Visa / Mastercard) as answered by the C's back in session 16 October 1994:




1) "On March 26, 2020 patent WO/2020/060606 was published. It is a Microsoft patent for cryptocurrency technology that is connected to the movements of a person’s body. Mining cryptocurrency has never been easier! Get a sensor implanted in your body and then do whatever the AI server tells you to do, and if you do it right, you will get some digital shekels!" - WO2020060606 CRYPTOCURRENCY SYSTEM USING BODY ACTIVITY DATA

2) "A new biometric identity platform partnered with the Gates-funded GAVI vaccine alliance and Mastercard will launch in West Africa and combine COVID-19 vaccinations, cashless payments, and potential law enforcement applications." - Africa to Become Testing Ground for "Trust Stamp" Vaccine Record and Payment System

USA ALERT!
H.R.6666 - COVID-19 Testing, Reaching, And Contacting Everyone (TRACE) Act116th Congress (2019-2020) | Get alerts
BILL
SEE:

Event 202 Solutions

And here is a link to 'Plandemic' on Banned.Video YouTube CENSORED: DOCTORS IN BLACK / PlanDemic

cassiopaea.org

 

[Jones]

Australian politician Riccardo Bosi is going over the applicable laws that restrictive measures and directives contravene. He covers the Biosecurity Act, the Privacy Act and also delves into laws regarding the military.

I haven't been too sure what to think about this guy, however listening to him speak this time I realise that my step father, an ex military man before he died, would most probably have liked him. My stepfather got sick and died froma condition that the military took responsibilty for and he swore blue when he found out.

AustraliaOne Party - Riccardo Bosi - Masks, Lockdowns, Mandatory Vaccines

UPDATED 05/07/2021 You can find out more by clicking on the below links: Bio Security Act 2015 - https://www.legislation.gov.au/Details/C2021C00196 Privacy Act 1988 - https://www.legislation.gov.au/De

rumble.com

Basically Bosi, an ex military man himself, is encouraging any military personnel to refrain from breaking any law mentioned above if they are ordered to enforce restrictive measures and directives.