Evolution 2.0

annp

The Living Force
FOTCM Member
The recent spate of reading I've been doing has revealed unprecedented insights into our physical make-up and what we are confronted with in terms of learning about our machine, and also has revealed the "gaps" in mainstream knowledge where only spirit/information can fit. I've been inviting all to come along on this quest and I can pretty much guarantee that if peeps will do their best to keep up, the knowledge input will have profound effects physically, mentally, emotionally, and spiritually.
It is already having profound effects - thank you so much for sharing this with us.

Am making my way through the book now and it’s a fascinating read. Each chapter gives a new awareness and respect for the miracle of life - often feel awestruck. The idea that any scientist could pretend that the complex design of our cells could have resulted from random mutations is just baffling. Denying the existence of a higher order intelligence in order to maintain an ideology ..what hubris!
 

genero81

The Living Force
FOTCM Member
Am making my way through the book now and it’s a fascinating read. Each chapter gives a new awareness and respect for the miracle of life - often feel awestruck. The idea that any scientist could pretend that the complex design of our cells could have resulted from random mutations is just baffling. Denying the existence of a higher order intelligence in order to maintain an ideology ..what hubris!
I don't know if it's hubris. I think it has the flavor of fanatic fundamentalism in material existence/ atheism. And it based on faulty assumptions. Assumptions that have been proved wrong or at least highly unlikely by science that's already been available for some time! That means there are those who know this and yet Neo- Darwinism is still being taught! But it's beyond me what one gets out of the belief that it's all meaningless. Unless it's some form of freedom from responsibility. I dunno
 

findit

Jedi
Thank you for the book recommendations! I just finished Virolution and Mr. Ryan’s discussions are amazing. The topics on retroviruses, and methyl and histone markers gave me plenty to think about as well as more questions. Information theory/consciousness is taking on even more meaning. What’s amazing to me is how fragile all of this information is. Just four molecules in a methyl group to act as a marker. What keeps all of these markers in place? Or a retrovirus that holds the first four cells of the embryo in place? I’m still blown away by these discussions.
 

JGeropoulas

The Living Force
FOTCM Member
I got the book and can't wait to begin reading it. Also, wanted to share a quote from nearly 100 years ago:

"Heredity is nothing but stored environment."
-- Luther Burbank (1849-1926) - American botanist, horticulturist and pioneer in agricultural science. He developed more than 800 strains and varieties of plants over his 55-year career. (It seemed oddly ironic (?) that such a uniquely curious and insightful guy would die from something so mundane: unremitting hiccups that lead to heart failure.)
 
Last edited:

Neil

Jedi Council Member
FOTCM Member
I enjoyed this book. It covers a lot of territory similar to the 5th Option, but I found it to be more approachable. Shiller seems tied down to presenting things in a very rigid format which causes him to repeat himself two or three times, with maybe slightly more detail each time, causing the book to drag, even though the material itself is interesting. Marshall sets up his engineering template in the beginning, makes his points, and moves on. I think his "condensed and distilled" presentation creates greater general interest for the public. I didn't mind the religious bent too much, it allowed his metaphysical philosophy to be presented in a much more straightforward way than in Shiller's book, which is more detailed but also more prone to "airy pontificating." Yes, he puts a bit too much stock in the Bible; there were a couple of points in Appendix 2 where he "decodes" Genesis that made me sigh when he tries to put the square peg in the round hole, but I saw what he was trying to do for people who are still kind of under the thumb of Judeo-Christian social engineering. Overall, definitely worth a read.
 

genero81

The Living Force
FOTCM Member
I enjoyed this book. It covers a lot of territory similar to the 5th Option, but I found it to be more approachable. Shiller seems tied down to presenting things in a very rigid format which causes him to repeat himself two or three times, with maybe slightly more detail each time, causing the book to drag, even though the material itself is interesting. Marshall sets up his engineering template in the beginning, makes his points, and moves on. I think his "condensed and distilled" presentation creates greater general interest for the public. I didn't mind the religious bent too much, it allowed his metaphysical philosophy to be presented in a much more straightforward way than in Shiller's book, which is more detailed but also more prone to "airy pontificating." Yes, he puts a bit too much stock in the Bible; there were a couple of points in Appendix 2 where he "decodes" Genesis that made me sigh when he tries to put the square peg in the round hole, but I saw what he was trying to do for people who are still kind of under the thumb of Judeo-Christian social engineering. Overall, definitely worth a read.
Good review Neil, I'm almost done with the book. I think it should be a must read for education for the fact that it makes clear that DNA is code, which implies a coder with a mind. Does that mean that God is the coder? Not sure it's necessary to jump to that conclusion. Didn't the C's say something about one day that we would 'seed' 3rd density Universes?
 

Neil

Jedi Council Member
FOTCM Member
genaro81 said:
Good review Neil, I'm almost done with the book. I think it should be a must read for education for the fact that it makes clear that DNA is code, which implies a coder with a mind. Does that mean that God is the coder? Not sure it's necessary to jump to that conclusion. Didn't the C's say something about one day that we would 'seed' 3rd density Universes?
Yes, that is one of his weaknesses. If one is going to use theism as the underlying ideology to inform one's reality, then I think polytheism is a much closer approximation of reality than monotheism. In monotheism, one has a very compacted and impoverished view of reality; there are angels and devils, God, Satan, Humanity, and that's it. Polytheists seem to have some concept of an all-father God, that presides over everything, and then a bunch of lesser gods who partake in all sorts of activities that fall in between the human and spiritual realms of experience, some of which aren't particularly holy. When 4D denizens interact with our reality, polytheism has more flexibility to frame the interaction in a reasonably correct ontology. I would personally argue that polytheism is sort of a degraded form of panpsychic scientism that may have existed in the ancient past which allows for aliens as well as "gods," (depending on how you define that term) and that's actually the correct direction to go in. DCM may be the ultimate coder, but there are other things going on.

Developing this line further, I thought that Daniella Fenton's book Hybrid Humans: Scientific Evidence of Our 800,000 Year-Old Alien Legacy could be read as a supplement to Evolution 2.0 as a way to counterbalance Perry Marshall's religious gloss as long as the following warning from the Cassiopaeans is kept in mind.
session941223 said:
Q: (L) Well, if you were Orion STS and we asked who you were, wouldn't you say you were the Cassiopaeans?
A: No. Pleiadians. That is "trendy" thus deceptive.
While some of the impetus behind the book is inspired by channeled material that's kind of a mixed bag, I believe the overarching idea is pretty accurate, even if I differ with some of the details. She touches on a lot of the concepts brought up in Evolution 2.0 and builds on Marshall's "knife blades" with some ideas very familiar to this forum. The seeding of Earth by extraterrestrial intelligences via viral methods is one scenario that is explicitly mentioned. I'm not sure that I would consider her scientific evidence a smoking gun regarding the alien involvement in the origins of humanity, the book feels a little weak taken on its own, but there are enough curiosities to point me in the direction that something like that was going on. It's a slim volume and it only took me about 3 hours to read.
 
Last edited:

Approaching Infinity

Administrator
Administrator
Moderator
FOTCM Member
Yes, that is one of his weaknesses. If one is going to use theism as the underlying ideology to inform one's reality, then I think polytheism is a much closer approximation of reality than monotheism. In monotheism, one has a very compacted and impoverished view of reality; there are angels and devils, God, Satan, Humanity, and that's it. Polytheists seem to have some concept of an all-father God, that presides over everything, and then a bunch of lesser gods who partake in all sorts of activities that fall in between the human and spiritual realms of experience, some of which aren't particularly holy.
It's pretty much semantics. Polytheisms may have a 'father god', but that can be a weak image to get across the concept of a universal cosmic mind, as it puts God on the level of the rest of the gods. I'd call THAT impoverished, philosophically/theologically if not in terms of just being a good story that gets the point across. Of course, there are impoverished monotheisms too, but even then the scale of beings you summed up is pretty comprehensive: angels and devils run the gamut of what are otherwise called gods in polytheistic pantheons, sharing their essential features in all but name. But many modern believers are so enamoured with materialism, even if they don't know it, that their scale of beings pretty much jumps from humans to God. If I remember correctly, Richard Carrier has a pretty good discussion of polytheism and its overlap with monotheism in his book on the historicity of Jesus.
 

Laura

Administrator
Administrator
Moderator
FOTCM Member
Well, I've recently finished Freeman Dyson's "Origins of Life" and now am working my way through John Maynard Smith's "The Origins of Life: From the Birth of Life to the Origin of Language" and I swear, I feel sorry for those guys; they are freaking helpless to deal with the matter at hand because of their extreme, biased, materialistic position. Smith keeps hitting the "Catch 22" and he even says so; but then he hopefully says that "in a couple of decades or so, science will be able to figure this out". His problem is that in order for life to begin, a few very basic things must happen SIMULTANEOUSLY, and he just can't get it to happen because he's got the "chicken and egg" issue: you can't have an egg without a chicken and you can't have a chicken without an egg.

He struggles mightily with the problems, freely admitting again and again that this or that system needs some other system first, but the other system needed first, can't come into being without the other one, and so on and on. It's a really sad thing to read. BUT, it sure is interesting in the stuff you learn on the side about modern scientific investigations into the world of cells. Absolutely fascinating! And once you get the full picture of the cell, you realize that, nope, this could not just "emerge from matter" without any guidance.

The upshot of my scientific explorations is a deepening conviction in the Cs overarching presentation of our reality including "Unified Thought Form" type situations that actually do the "creating" of life, so to say. And the science seems to reveal the gaps in the materialistic presentation where such activity MUST have been involved.

Q: (L) Now you mentioned the creators of your group as the super ancient ancestors called the transient passengers, what is the meaning of this term and who are these beings?

A: Transient passengers are not beings. Transient Passengers are unified thought form.

Q: (L) Why are they called transient passengers?

A: Because they transit all forms of reality. And they spring forth from the Unified form of existence.

I'm going to be asking some questions about it at the next session.
 

Neil

Jedi Council Member
FOTCM Member
Approaching Infinity said:
It's pretty much semantics. Polytheisms may have a 'father god', but that can be a weak image to get across the concept of a universal cosmic mind, as it puts God on the level of the rest of the gods. I'd call THAT impoverished, philosophically/theologically if not in terms of just being a good story that gets the point across. Of course, there are impoverished monotheisms too, but even then the scale of beings you summed up is pretty comprehensive: angels and devils run the gamut of what are otherwise called gods in polytheistic pantheons, sharing their essential features in all but name. But many modern believers are so enamoured with materialism, even if they don't know it, that their scale of beings pretty much jumps from humans to God. If I remember correctly, Richard Carrier has a pretty good discussion of polytheism and its overlap with monotheism in his book on the historicity of Jesus.
Well, OK. In the Christianity I was raised in, you had God, and the angels existed pretty much just to sing praises to God, and be God's messengers. Satan existed as a sort of test of the faithful, and he sent his demons into the world to tempt humans and add to his legions. The purpose of my life was to accept Jesus Christ as savior and unquestioningly accept the tenants of the Bible (with greater emphasis on the New Testament) as the divine revelation of God to prove my devotion. That was pretty much my entire theological reality when I was in Church, the rest of the Bible was just detail to explain why it was so. When I started reading the classics, I became interested in the Greek pantheon with all of its different levels of gods, from the abstract like Chaos, to the more mundane mythical heroes like Perseus. The gods were not black and white characters but had different agendas and frequently interacted with human reality where the Biblical God was mostly limited to passing judgement from his high perch. Jesus was sort of a one-off thing, and we were all supposed to wait around until he would intervene again in the second coming and save everybody. In my early teens, I imagined the different classes of beings such as nymphs and satyrs and so forth existed in parallel realities. The fact that one may choose certain archetypes to align with other than everything being reduced to the pure good/pure evil dichotomy in Christianity intrigued me and felt more realistic. My fixation with Greek mythology only lasted a couple of years, I thought some of it was allegorical, and some of it was just made up like I suspected Christianity was, but it gave me a lot to think about; the mainstream Christianity just felt so "dead" by comparison.




So I view it as kind of a funnel. In the context of this discussion, we can view the above image as a representation of the way the thought center of non-being perturbs the consciousness of those who get closer and closer to its frequency via the belief system they adopt. The closer you are to the singularity, the less energy you have to decode the reality you interact with and the more mechanical your choices become; everything is basically determined by the overwhelming strength of the gravity well. Inside the singularity, you have the hardcore Neodarwinist/Materialists, true atheists, and solipsistic people. They have pretty much been completely cut off from the creative forces of the universe and are being pulverized into the most primal matter by the infinite density of nihilistic self-absorption that exists at the bottom of the black hole of non-being. Near the bottom of the funnel, near the event horizon, I would place the mainstream Judaic religions, not completely cut off, but the consciousness who is at this level has a very narrow view of things and they are ensconced in so many lies that their experience of reality is overwhelmingly dictated by the gravity well. In the midsection of the funnel, I would put religions such as the Hellenistic religion and Hinduism; still heavily influenced, but not as constrained. In the upper part of the funnel, I might put things such as 5th Option-esque theories, certain Buddhist sects, maybe Sufism. At this level, they are still significantly influenced by the gravity well, but have a much broader view of things, and more freedom to choose because they have more objective knowledge with which to dance with their reality. One is markedly making strides towards being a real conscious being the higher you go. If "Cassiopaean-ism" were ever to be wholly codified, it would probably exist outside of the funnel, in the unperturbed realm of "free thought," unhindered by lies and existing in constant communion with the creative force.
 

gnosisxsophia

Jedi Master
The upshot of my scientific explorations is a deepening conviction in the Cs overarching presentation of our reality including "Unified Thought Form" type situations that actually do the "creating" of life, so to say. And the science seems to reveal the gaps in the materialistic presentation where such activity MUST have been involved.

Q: (L) Now you mentioned the creators of your group as the super ancient ancestors called the transient passengers, what is the meaning of this term and who are these beings?

A: Transient passengers are not beings. Transient Passengers are unified thought form.

Q: (L) Why are they called transient passengers?

A: Because they transit all forms of reality. And they spring forth from the Unified form of existence.

I'm going to be asking some questions about it at the next session.

Excellent, look forward to the responses :-)

The unified thought form / transient passenger as 'creator' is a very intriguing idea?


Q: (T) So, you are not really Cassiopaeans from the Constellation Cassiopeia?
A: We are Transient Passengers.

In light of the equivalency to 'realms' -


Q: (L) Well, are these Transient Passengers Realms?
A: Yes. So are you.

And 'Wanderers' -


Q: (L) Are there 6th density Orions known as Transient Passengers?
A: Yes.
Q: (L) So there are Transient Passengers that are STO as well as STS?
A: TP is “wanderer”.
Q: (L) And what is a wanderer?
A: TP.
Q: (L) Well, the idea of the Wanderers, according to the Ra Material, is 4th or 5th density beings that have chosen to come back into 3rd density to help us. Would that be the same kind of Wanderer?
A: 5th or 6th density.

Which seems to equate with Ra's 'social memory complex' and also calls to mind the allusion of the LLC group being comprised of two 6D and one 5D 'Wanderer'.

Making one wonder if a connection can be made between the subject of perpendicular realities / realms and 'the court of seven' or the position that a uniting of wanderers / TPs or emmisaries of a 'unified thought form' may constitute 'of itself' a realm border crossing?


Q: (L) Are there other parts of us in all realms doing other things at this moment?
A: Yes.
Q: (L) And how is this going to be affected by the realm border crossing?
A: Will merge.
Q: (L) Do we need to do extensive hypnosis to bring these aspects of ourselves up and deal with these things a little at a time?
A: Will happen involuntarily. Will be like a thermonuclear blast.

Altering DNA among other things?
 

Laura

Administrator
Administrator
Moderator
FOTCM Member
I've put some notes together for the next session and thought I'd share them here; it's basically just background of the current reading but should help to orient folks. As I was searching for data and details, I was struck by a few things that really rang a bell: the 3-5 Code Cs talked about long time ago.

The book is
The Origins of Life by John Maynard Smith and Eors Szathmary

Authors say: Evolution by natural selection lacks foresight. A transition may open up new possibilities for future evolution, but that is not why it happened.

Before there were specific enzymes, the maximum size of the genome was about 20 bases. A sort of Catch-22. With a mere 20 bases, one cannot code for an enzyme, let alone the translating machinery needed to convert the base sequence into a specific protein.

But, RNA molecules can themselves be enzymes.

The difference between RNA and DNA is chemically minor: the backbone is slightly different, and one of the bases of DNA, thymidine, is replaced in RNA by uridine. Uridine can replace thymidine as a pair for adenine. Plus, RNA usually exists as a single strand. The error rate in RNA replication is in the range of 1/1000 to 1/10,000. RNA can have a variety of secondary structures. The molecule can be bent back on itself and make loops. The stems of the loops form base pairs. That pairing is always between strands in reverse orientation. DNA and RNA strands have a polarity and pairing can occur only between strands pointing in opposite directions. RNA molecules, therefore, can have a diversity of three-dimensional structures while all DNA have much the same double helix structure. This means that RNA molecules, like proteins, should be able to act as enzymes: ribozymes. RNA can perform both functions: carriers of information and enzymes.

Background on genetic code:
the genetic code is 'written' in a linear sequence in four letters corresponding to two purines, A and G (adenine and guanine), and two pyrimidines, C and T (cytosine and thymine); in mRNA, U (uracil) replaces T. The words of the alphabet comprise 3 letters, thus there are 43=64 permutations or words which are called codons. 61 of the 64 codons code for 1 of 20 amino acids. Since more than one codon codes for a particular amino acid the code is said to be redundant. Four of the 64 codons punctuate the message; one, AUG, is the start signal and three, UAG, UAA and UGA, are stop signals.



Adenine is a nucleobase (a purine derivative). Its derivatives have a variety of roles in biochemistry including cellular respiration, in the form of both the energy-rich adenosine triphosphate (ATP) and the cofactors nicotinamide adenine dinucleotide (NAD) and flavin adenine dinucleotide (FAD). It also has functions in protein synthesis and as a chemical component of DNA and RNA. The shape of adenine is complementary to either thymine in DNA or uracil in RNA.

Cytosine is one of the four main bases found in DNA and RNA, along with adenine, guanine, and thymine (uracil in RNA). It is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attached (an amine group at position 4 and a keto group at position 2). The nucleoside of cytosine is cytidine. In Watson-Crick base pairing, it forms three(3) hydrogen bonds with guanine.

Thymine is one of the four nucleobases in the nucleic acid of DNA. As its alternate name (5-methyluracil) suggests, thymine may be derived by methylation of uracil at the 5th carbon. In RNA, thymine is replaced with uracil in most cases. In DNA, thymine (T) binds to adenine (A) via two hydrogen bonds, thereby stabilizing the nucleic acid structures. Thymine combined with deoxyribose creates the nucleoside deoxythymidine, which is synonymous with the term thymidine.

In March 2015, NASA scientists reported that, for the first time, complex DNA and RNA organic compounds of life, including uracil, cytosine and thymine, have been formed in the laboratory under outer space conditions, using starting chemicals, such as pyrimidine, found in meteorites. Pyrimidine, like polycyclic aromatic hydrocarbons (PAHs), the most carbon-rich chemical found in the Universe, may have been formed in red giants or in interstellar dust and gas clouds, according to the scientists.[3] Thymine has not been found in meteorites, which suggests the first strands of DNA had to look elsewhere to obtain this building block. Thymine likely formed within some meteorite parent bodies, however may not have persisted within these bodies due to an oxidation reaction with hydrogen peroxide.

Guanine is one of the four main nucleobases found in the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine (uracil in RNA). In DNA, guanine is paired with cytosine. The guanine nucleoside is called guanosine.

Guanosine is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine can be phosphorylated to become guanosine monophosphate (GMP), cyclic guanosine monophosphate (cGMP), guanosine diphosphate (GDP), and guanosine triphosphate (GTP). These forms play important roles in various biochemical processes such as synthesis of nucleic acids and proteins, photosynthesis, muscle contraction, and intracellular signal transduction (cGMP). When guanine is attached by its N9 nitrogen to the C1 carbon of a deoxyribose ring it is known as deoxyguanosine. The antiviral drug aciclovir, often used in herpes treatment, and the anti-HIV drug abacavir, are structurally similar to guanosine.

Uracil is one of the four nucleobases in the nucleic acid of RNA that are represented by the letters A, G, C and U. The others are adenine (A), cytosine (C), and guanine (G). In RNA, uracil binds to adenine via two hydrogen bonds. In DNA, the uracil nucleobase is replaced by thymine. Uracil is a demethylated form of thymine. … Uracil is a common and naturally occurring pyrimidine derivative. It is a planar, unsaturated compound that has the ability to absorb light. Based on 12C/13C isotopic ratios of organic compounds found in the Murchison meteorite, it is believed that uracil, xanthine and related molecules can also be formed extraterrestrially. In RNA, uracil base-pairs with adenine and replaces thymine during DNA transcription. Methylation of uracil produces thymine.

Uracil also recycles itself to form nucleotides by undergoing a series of phosphoribosyltransferase reactions.[2] Degradation of uracil produces the substrates aspartate, carbon dioxide, and ammonia.

Oxidative degradation of uracil produces urea and maleic acid in the presence of H2O2 and Fe2+ or in the presence of diatomic oxygen and Fe2+.

Uracil is rarely found in DNA, and this may have been an evolutionary change to increase genetic stability. This is because cytosine can deaminate spontaneously to produce uracil through hydrolytic deamination. Therefore, if there were an organism that used uracil in its DNA, the deamination of cytosine (which undergoes base pairing with guanine) would lead to formation of uracil (which would base pair with adenine) during DNA synthesis. Uracil-DNA glycosylase excises uracil bases from double-stranded DNA. This enzyme would therefore recognize and cut out both types of uracil – the one incorporated naturally, and the one formed due to cytosine deamination, which would trigger unnecessary and inappropriate repair processes.

In a scholarly article published in October 2009, NASA scientists reported having reproduced uracil from pyrimidine by exposing it to ultraviolet light under space-like conditions. This suggests that one possible natural original source for uracil in the RNA world could have been panspermia. More recently, in March 2015, NASA scientists reported that, for the first time, additional complex DNA and RNA organic compounds of life, including uracil, cytosine and thymine, have been formed in the laboratory under outer space conditions, using starting chemicals, such as pyrimidine, found in meteorites. Pyrimidine, like polycyclic aromatic hydrocarbons (PAHs), the most carbon-rich chemical found in the Universe, may have been formed in red giants or in interstellar dust and gas clouds, according to the scientists.

The association between amino acids and codon – for example, between UAC and tyrosine – is called the genetic code. Three of the possible 64 codons do not code for an amino acid, but are ‘stop’ codons, terminating translation. When such a stop is reached, no further amino acids are added to the chain which is released from the ribosome as a complete protein. The meaning of the code – that UAC specifies tyrosine and not some other amino acid – depends on the fact that the tRNA with the anti-codon AUG also has attached to it the amino acid tyrosine. … The attachment enzyme assigns a particular codon to a particular amino acid. The code is therefor chemically arbitrary. By altering the sequence of a tRNA, or the specificity of an assignment enzyme, the code would be altered. Mutations, usually lethal, that alter the code in these ways are known. It is still an open question whether the code was always arbitrary or whether there was once a good chemical reason whay UAC specific Tyrosine.

All existing organisms have this system, essentially. There is nothing in between.

The genetic code is highly similar among all organisms and can be expressed in a simple table with 64 entries.

The code defines how sequences of nucleotide triplets, called codons, specify which amino acid will be added next during protein synthesis. With some exceptions, a three-nucleotide codon in a nucleic acid sequence specifies a single amino acid.

codons consist of three DNA bases

the codon UUU specified the amino acid phenylalanine.

the codon AAA specified the amino acid lysine

the codon CCC specified the amino acid proline.

While the "genetic code" determines a protein's amino acid sequence, other genomic regions determine when and where these proteins are produced according to various "gene regulatory codes".

In a broad academic audience, the concept of the evolution of the genetic code from the original and ambiguous genetic code to a well-defined ("frozen") code with the repertoire of 20 (+2) canonical amino acids is widely accepted.

Since 2001, 40 non-natural amino acids have been added into protein by creating a unique codon (recoding) and a corresponding transfer-RNA:aminoacyl – tRNA-synthetase pair to encode it with diverse physicochemical and biological properties in order to be used as a tool to exploring protein structure and function or to create novel or enhanced proteins.

H. Murakami and M. Sisido extended some codons to have four and five bases. Steven A. Benner constructed a functional 65th (in vivo) codon.

In 2015 N. Budisa, D. Söll and co-workers reported the full substitution of all 20,899 tryptophan residues (UGG codons) with unnatural thienopyrrole-alanine in the genetic code of the bacterium Escherichia coli.

In 2016 the first stable semisynthetic organism was created. It was a (single cell) bacterium with two synthetic bases (called X and Y). The bases survived cell division.

In 2017, researchers in South Korea reported that they had engineered a mouse with an extended genetic code that can produce proteins with unnatural amino acids.

A reading frame is defined by the initial triplet of nucleotides from which translation starts. It sets the frame for a run of successive, non-overlapping codons, which is known as an "open reading frame" (ORF). For example, the string 5'-AAATGAACG-3' if read from the first position, contains the codons AAA, TGA, and ACG ; if read from the second position, it contains the codons AAT and GAA ; and if read from the third position, it contains the codons ATG and AAC. Every sequence can, thus, be read in its 5' → 3' direction in three reading frames, each producing a possibly distinct amino acid sequence: in the given example, Lys (K)-Trp (W)-Thr (T), Asn (N)-Glu (E), or Met (M)-Asn (N), respectively (when translating with the vertebrate mitochondrial code). When DNA is double-stranded, six possible reading frames are defined, three in the forward orientation on one strand and three reverse on the opposite strand.

The most common start codon is AUG, which is read as methionine or, in bacteria, as formylmethionine. Alternative start codons depending on the organism include "GUG" or "UUG"; these codons normally represent valine and leucine, respectively, but as start codons they are translated as methionine or formylmethionine.

The three stop codons have names: UAG is amber, UGA is opal (sometimes also called umber), and UAA is ochre. Stop codons are also called "termination" or "nonsense" codons. They signal release of the nascent polypeptide from the ribosome because no cognate tRNA has anticodons complementary to these stop signals, allowing a release factor to bind to the ribosome instead.
 

birger

The Force is Strong With This One
Really interesting.
The stop codons sounds like “null-terminated strings” in programming languages.
When the “compiler” reaches a “null byte”, everything thereafter is discarded.
Seems so similar to a programming language, guess it is THE programming language of this “simulation” we exist in.
 

fabric

Ambassador
Ambassador
FOTCM Member
That part about reading the sequences is very interesting! Here are the older sessions for reference:

Session 11 November 1995

A: Look: 3 5 3 5 3 5.

Q: (L) What is the 3 5 sequence?

A: 5 minus 3.

Q: (L) Okay, we have strange math. But, you can do anything with numbers because they correspond to the universe at deep levels...

A: Is code.

Q: (L) What does this code relate to? Is it letters or some written work?

A: Infinite power.

Session 21 December 1996

Q: Would you say that the writings of Albert Pike might be interesting to decode?

A: Yes.

Q: (L) Is there any particular number sequence that could be used?

A: 353535...

Q: (L) Is this also a genetic code?

A: Much is missing between "point A and point B."

Q: (L) You mean by jumping from documents to DNA?

A: Yes.

Session 20 August 2001

Q: If the Levites were the Hittite Moon worshipers, how come Akhenaten, who hung out with Nefertiti, instituted Sun worship? That doesn't make sense.
A: Future Ho into.
Q: Future what into?
A: Ho.
Q: HO must stand for something. I don't understand. Was Nefertiti responsible for Akhenaten's Sun worship?
A: Mostly.
Q: Well why did it turn into Sun worship instead of Moon worship?
A: Future honor of Ra. Go 353535. Deity.
Q: So in other words they were laying a foundation for future layering of other concepts?
A: Yes.
Q: Was the Temple on Crete at Knossos, was it really a necropolis as Wunderlich suggests?
A: 5th density waiting room.
Q: Did they sacrifice humans there?
A: Yes.
Q: Did they sacrifice animals?
A: Yes.
Q: What animals were they sacrificing, and to whom?
A: Apis Bull in part.
Q: What was the other part?
A: Haho 353535
Q: "Ho" must be a name. Is Ho a name of a god?
A: HOH 353535
Q: (T) Is it water? (L) Is it like Hawah? (A) HOH water?
A: Remember Irish pig.
And this bit here from an earlier thread:


If you read Answer to The Ultimate Question Of Life, the Universe, and Everything the answer should be 42. But this may well be a code. 4+1=5 and 2+1=3, so we get 53. Which reversed is 35.
On the other hand, going deeper into The Code Problem we can find that:

The sequence of DNA can be analyzed for open reading frames (usually done by computer). Open reading frames are stretches of DNA that do not contain stop codons (UAA, UGA, UAG). A segment of double-stranded DNA has six possible reading frames, three in each direction.

Consider the double-stranded DNA sequence below

5' CAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAATCCGAG 3'
3' GTTACCGATCCATGATACATACTCTAGTACTAGAAATGTTTAGGCTC 5'

If we convert the top and the bottom sequences to RNA, the three frames of the top strand could be represented as follows:

1. 5' CAA UGG CUA GGU ACU AUG UAU GAG AUC AUG AUC UUU ACA AAU CCG AG 3'
2. 5' CA AUG GCU AGG UAC UAU GUA UGA GAU CAU GAU CUU UAC AAA UCC GAG 3'
3. 5' C AAU GGC UAG GUA CUA UGU AUG AGA UCA UGA UCU UUA CAA AUC CGA G 3'

The three frames of the bottom strand could be represented as follows (remember this is shown 5' to 3')

1. 5' CUC GGA UUU GUA AAG AUC AUG AUC UCA UAC AUA GUA CCU AGC CAU UG 3'
2. 5' CU CGG AUU UGU AAA GAU CAU GAU CUC AUA CAU AGU ACC UAG CCA UUG 3'
3. 5' C UCG GAU UUG UAA AGA UCA UGA UCU CAU ACA UAG UAC CUA GCC AUU G 3'

Last, but not least, typing in Google:

"3-5" code
the first entry that comes is (suprise, suprise! :) )

Cassiopaea
 
Top Bottom